OLIGONUCLEOTIDES

Set Descending Direction

1-40 of 88 Items

Page:
  1. 1
  2. 2
  3. 3
StructurePropertiesAvailabilityPricing

UP 2016-06-02 20:29:25

ISOMALTOOLIGOSACCHARIDES,,OLG0000031,
ACCC Cat. No. OLG0000031
Name ISOMALTOOLIGOSACCHARIDES
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 505.25
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:18:14

5'-DMT-DG(IBU)-SUC-CPG,,OLG0000247,
ACCC Cat. No. OLG0000247
Name 5'-DMT-DG(IBU)-SUC-CPG
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 498.21
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:40

TOP STRAND SELECTION OLIGONUCLEOTIDE,,OLG0000030,
ACCC Cat. No. OLG0000030
Name TOP STRAND SELECTION OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.64
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:40

HUMAN PROSTATE TOTAL RNA,,OLG0000204,
ACCC Cat. No. OLG0000204
Name HUMAN PROSTATE TOTAL RNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 496.36
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:20:05

HUMAN KIDNEY CLONCAPTURE-READY SUPER DNA,,OLG0000213,
ACCC Cat. No. OLG0000213
Name HUMAN KIDNEY CLONCAPTURE-READY SUPER DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 496.23
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:40

HUMAN LIVER TOTAL RNA,,OLG0000242,
ACCC Cat. No. OLG0000242
Name HUMAN LIVER TOTAL RNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 501.79
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 18:51:44

PCDNA 3.1 (-)/MYC-HIS C EXPRESSION VECTOR,,OLG0000248,
ACCC Cat. No. OLG0000248
Name PCDNA 3.1 (-)/MYC-HIS C EXPRESSION VECTOR
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.79
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:20:41

TELOHI DNA,,OLG0000238,
ACCC Cat. No. OLG0000238
Name TELOHI DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 502.01
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 19:03:06

MRNA IN SITU HYBRIDIZATION SOLUTION,,OLG0000230,
ACCC Cat. No. OLG0000230
Name MRNA IN SITU HYBRIDIZATION SOLUTION
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.95
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:39:30

DMT-DG(TAC) AMIDITE,,OLG0000228,
ACCC Cat. No. OLG0000228
Name DMT-DG(TAC) AMIDITE
CAS No. N/A
Molecular Formula C52H62N7O9P
Molecular Weight 960.06
Details
Inquire
5 MG 505.62
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:40

5'-D (GCGCGAAATTAACCCTCACTAAAG) -3',,OLG0000234,
ACCC Cat. No. OLG0000234
Name 5'-D (GCGCGAAATTAACCCTCACTAAAG) -3'
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.55
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:32

NF-KAPPA-B OLIGONUCLEOTIDE,,OLG0000023,
ACCC Cat. No. OLG0000023
Name NF-KAPPA-B OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 501.57
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 03:48:43

5'-O-(4,4-DIMETHOXYTRITYL)-2'-O-[(TERT-BUTYL)DIMETHYLSILYL]-N-[[4-(TERT-BUTYL)PHENOXY]ACETYL]ADENINE-3'-(2-CYANOETHYL-N,N-DIISOPROPYL)PHOSPHORAMIDITE,149989-64-0,OLG0000093,
ACCC Cat. No. OLG0000093
Name 5'-O-(4,4-DIMETHOXYTRITYL)-2'-O-[(TERT-BUTYL)DIMETHYLSILYL]-N-[[4-(TERT-BUTYL)PHENOXY]ACETYL]ADENINE-3'-(2-CYANOETHYL-N,N-DIISOPROPYL)PHOSPHORAMIDITE
CAS No. 149989-64-0
Molecular Formula C58H76N7O9PSi
Molecular Weight 1074.32
Details
Inquire
5 MG 503.92
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:23

CHLORAMPHENICOL REPAIR OLIGONUCLEOTIDE,,OLG0000022,
ACCC Cat. No. OLG0000022
Name CHLORAMPHENICOL REPAIR OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 501.00
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:19:49

5'-CGCCTTCTATTTCAAACTCGTGCC-3',,OLG0000221,
ACCC Cat. No. OLG0000221
Name 5'-CGCCTTCTATTTCAAACTCGTGCC-3'
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 501.92
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 03:43:56

GTI 2040,236391-66-5,OLG0000095,
ACCC Cat. No. OLG0000095
Name GTI 2040
CAS No. 236391-66-5
Molecular Formula C193H246N77O97P19S19
Molecular Weight 6394.21
Details
Inquire
5 MG 497.06
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2017-06-24 03:33:30

DEOXYRIBONUCLEIC ACID,100403-24-5,OLG0000287,
ACCC Cat. No. OLG0000287
Name DEOXYRIBONUCLEIC ACID
CAS No. 100403-24-5
Molecular Formula Not Available
Molecular Weight 0.00
Details
Inquire
5 MG 459.56
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:08:02

MAP KINASE ANTISENSE OLIGONUCLEOTIDE, NEGATIVE CONTROL,,OLG0000033,
ACCC Cat. No. OLG0000033
Name MAP KINASE ANTISENSE OLIGONUCLEOTIDE, NEGATIVE CONTROL
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.46
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:18:14

5' PHOSPHORYLATING II AMIDITE,,OLG0000255,
ACCC Cat. No. OLG0000255
Name 5' PHOSPHORYLATING II AMIDITE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.06
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:34

PGEM(R)-LUC DNA,,OLG0000257,
ACCC Cat. No. OLG0000257
Name PGEM(R)-LUC DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 501.69
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:55

PCITE(R)-4C(+) DNA,,OLG0000206,
ACCC Cat. No. OLG0000206
Name PCITE(R)-4C(+) DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.71
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:36

HCV NS-4, R-DNA,,OLG0000236,
ACCC Cat. No. OLG0000236
Name HCV NS-4, R-DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 498.65
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:19:49

5'-AAGAAGCCTGTGCAGCTACCAGG-3',,OLG0000235,
ACCC Cat. No. OLG0000235
Name 5'-AAGAAGCCTGTGCAGCTACCAGG-3'
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.31
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:04:40

TETRACYCLINE REPAIR OLIGONUCLEOTIDE,,OLG0000028,
ACCC Cat. No. OLG0000028
Name TETRACYCLINE REPAIR OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.83
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:55:00

PK-TAG 95-108,,OLG0000243,
ACCC Cat. No. OLG0000243
Name PK-TAG 95-108
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 498.53
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:19:42

CALF LIVER TRNA,,OLG0000249,
ACCC Cat. No. OLG0000249
Name CALF LIVER TRNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 498.69
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:08:00

BD BACULOGOLD BRIGHT LINEARIZED BACULOVIRUS DNA,,OLG0000246,
ACCC Cat. No. OLG0000246
Name BD BACULOGOLD BRIGHT LINEARIZED BACULOVIRUS DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 496.29
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:27

DNA MOLECULAR WEIGHT MARKER XIII,,OLG0000239,
ACCC Cat. No. OLG0000239
Name DNA MOLECULAR WEIGHT MARKER XIII
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 499.48
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:08:00

LINEARIZED ACRP23.LACZ BACULOVIRUS DNA,,OLG0000214,
ACCC Cat. No. OLG0000214
Name LINEARIZED ACRP23.LACZ BACULOVIRUS DNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.28
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 03:48:43

2'-O-[(TERT-BUTYL)DIMETHYLSILYL]-N-[[4-(TERT-BUTYL)PHENOXY]ACETYL]GUANOSINE-3'-(2-CYANOETHYL-N,N-DIISOPROPYL)PHOSPHORAMIDITE,149989-68-4,OLG0000092,
ACCC Cat. No. OLG0000092
Name 2'-O-[(TERT-BUTYL)DIMETHYLSILYL]-N-[[4-(TERT-BUTYL)PHENOXY]ACETYL]GUANOSINE-3'-(2-CYANOETHYL-N,N-DIISOPROPYL)PHOSPHORAMIDITE
CAS No. 149989-68-4
Molecular Formula C58H76N7O10PSi
Molecular Weight 1090.32
Details
Inquire
5 MG 499.92
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:19:50

5'-CGTCGCCGTCCAGCTCGACCAG-3',,OLG0000207,
ACCC Cat. No. OLG0000207
Name 5'-CGTCGCCGTCCAGCTCGACCAG-3'
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 495.13
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 20:03:50

AMPICILLIN REPAIR OLIGONUCLEOTIDE,,OLG0000016,
ACCC Cat. No. OLG0000016
Name AMPICILLIN REPAIR OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 495.33
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:20:42

TS PRIMER,,OLG0000254,
ACCC Cat. No. OLG0000254
Name TS PRIMER
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 502.77
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2017-08-02 03:13:44

EDIFOLIGIDE,328538-04-1,OLG0000288,
ACCC Cat. No. OLG0000288
Name EDIFOLIGIDE
CAS No. 328538-04-1
Molecular Formula Not Available
Molecular Weight 0.00
Details
Inquire
5 MG 453.33
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-03 00:18:13

5'-DMT-T-SUC-CPG,,OLG0000252,
ACCC Cat. No. OLG0000252
Name 5'-DMT-T-SUC-CPG
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.78
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:53

OLIGO(DT)23, ANCHORED,,OLG0000035,
ACCC Cat. No. OLG0000035
Name OLIGO(DT)23, ANCHORED
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 504.94
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:08:24

RED NOVA LYSATE CONTROL RNA,,OLG0000245,
ACCC Cat. No. OLG0000245
Name RED NOVA LYSATE CONTROL RNA
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 497.52
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:55

PBAC(TM)-5 DNA TRANSFER PLASMID,,OLG0000251,
ACCC Cat. No. OLG0000251
Name PBAC(TM)-5 DNA TRANSFER PLASMID
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 498.93
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 21:08:02

MAP KINASE ANTISENSE OLIGONUCLEOTIDE,,OLG0000032,
ACCC Cat. No. OLG0000032
Name MAP KINASE ANTISENSE OLIGONUCLEOTIDE
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 503.11
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

UP 2016-06-02 22:54:53

OLIGO (DT)20 PROBE, BIOTIN-LABELED,,OLG0000034,
ACCC Cat. No. OLG0000034
Name OLIGO (DT)20 PROBE, BIOTIN-LABELED
CAS No. N/A
Molecular Formula Not Available
Molecular Weight
Details
Inquire
5 MG 499.62
100 MG Inquire
1 G Inquire
5 G Inquire
10 G Inquire
100 G Inquire

Set Descending Direction

1-40 of 88 Items

Page:
  1. 1
  2. 2
  3. 3